Journal: Nature Communications

Article Title: Liquid condensation of reprogramming factor KLF4 with DNA provides a mechanism for chromatin organization

doi: 10.1038/s41467-021-25761-7

Figure Lengend Snippet: a Fluorescence microscopy images of DNA (Hoechst), mTurq fluorescent tag (top), and KLF4-mTurq (bottom) in HEK 293T cells. Nuclear mTurq distribution is diffuse whereas KLF4-mTurq forms biomolecular condensates. Similar results were obtained for >5 biological replicates. b HEK 293T cells (top) and BJ fibroblasts (bottom) expressing KLF4-mTurq exhibit diffuse distribution (left), irregular puncta (middle), or droplets (right; circularity > 0.8). Similar results were obtained for 3 biological replicates. c Fluorescence recovery after photobleaching (FRAP) of KLF4-mTurq droplets in BJ fibroblasts (top row) bleached at positions indicated by white arrows; right panel is a recovery curve ( n = 8 droplets) and enlarged insets track one droplet (white square). FRAP of KLF4-mTurq puncta in HEK 293T cells (bottom row) bleached at positions indicated by white arrows and circle; right panel is a recovery curve ( n = 6 punctate fields). Data are presented as mean values ± SD. d Fluorescence image time course of droplet fusion (at white arrows) in BJ fibroblasts. Fusion was verified with 3D z-stack images. e Fluorescence microscopy image of KLF4-mTurq puncta and droplets in HEK 293T cells before (left) and after (right) 1,6-hexanediol treatment. Nucleus outline in white dashes. Similar results were obtained for 2 biological replicates.

Article Snippet: The KLF4 coding regions corresponding to the intrinsically disordered region (IDR, residues 2-417) or the DNA binding domain (DBD, residues 418–513) were amplified from the plasmid encoding human KLF4 gene (GeneArt) using primer sets KLF4-2F/KLF4-2R or KLF4-3F/KLF4-3R, respectively, and ligated into Bam HI/ Kpn I-digested pHRT-mTu-AH lentiviral transfer vector using Gibson Assembly Master Mix. pHRT-KLF4_R501A-mTu-AH.

Techniques: Fluorescence, Microscopy, Expressing

Journal: Nature Communications

Article Title: Liquid condensation of reprogramming factor KLF4 with DNA provides a mechanism for chromatin organization

doi: 10.1038/s41467-021-25761-7

Figure Lengend Snippet: a Domain organization of KLF4-mTurq constructs. b Fluorescence microscopy of mTurq fusions and DNA (Hoechst) in HEK 293T cells. KLF4 ΔDBD -mTurq (top) is found throughout cells and is diffuse in the nucleus; KLF4 ΔIDR -mTurq (bottom) localizes to the nucleus and forms condensates. Similar results were obtained results for 2 biological replicates. c HEK 293T cells expressing KLF4-mTurq variants classified as diffuse (gray) or punctate (red) are plotted by their mean fluorescence intensity; the long horizontal bars mark the median, and the top and bottom bars on the vertical lines denote the 90-10 percentiles. Diffuse cells expressing deletion constructs show very different fluorescence levels (statistical tests were performed using a two-sided Student’s paired t -test; P value shown; n = 105 cells each). KLF4 ΔIDR -mTurq expresses poorly and 48% of cells are punctate ( n = 97); KLF4 ΔDBD -mTurq expresses well and 6% of cells are punctate ( n = 7). Similar results were obtained for 2 biological replicates. d Bright field microscopy of 6 µM KLF4 DBD (left), with 10% PEG-8K (center) or 1 µM NANK (right) in TS buffer (12.5 mM Tris, 70 mM NaCl, pH 7.4). e Fluorescence microscopy of 6 µM DBD in TS buffer (with 50 nM DBD-AF594; red) and 1 µM NANK (with 100 nM YOYO-1; green); yellow droplets in merge indicate colocalization. Similar results were obtained for 2 replicates. f Fluorescence microscopy of DBD:NANK droplet time course taken at a focal plane close to the surface. Droplets form, grow, fuse and wet the surface. Similar results were obtained for >10 replicates. g FRAP of droplets monitoring NANK-AF488 (green; top row) or KLF4 DBD-AF594 (red; bottom row). Curves (at right) show mean and standard deviation for 15 droplets. h DNA concentration dependence of DBD:DNA liquid–liquid phase separation (LLPS). Fluorescence microscopy images of 6 µM DBD with NANK DNA (0–3 µM) in TS buffer with 100 nM YOYO-1 (green) after 30 min incubation. i LLPS measurements at various DBD and NANK concentrations; solid/open circles indicate LLPS/no LLPS. Images are scored as LLPS if the coefficient of variation (CV, standard deviation/mean pixel intensity) is >0.2 and the mean fluorescent intensity is >0.4 arbitrary units. Values were determined using ImageJ for 2–3 independent replicates.

Article Snippet: The KLF4 coding regions corresponding to the intrinsically disordered region (IDR, residues 2-417) or the DNA binding domain (DBD, residues 418–513) were amplified from the plasmid encoding human KLF4 gene (GeneArt) using primer sets KLF4-2F/KLF4-2R or KLF4-3F/KLF4-3R, respectively, and ligated into Bam HI/ Kpn I-digested pHRT-mTu-AH lentiviral transfer vector using Gibson Assembly Master Mix. pHRT-KLF4_R501A-mTu-AH.

Techniques: Construct, Fluorescence, Microscopy, Expressing, Standard Deviation, Concentration Assay, Incubation

Journal: Nature Communications

Article Title: Liquid condensation of reprogramming factor KLF4 with DNA provides a mechanism for chromatin organization

doi: 10.1038/s41467-021-25761-7

Figure Lengend Snippet: a Schematic of the NANOG promoter (top) and studied DNA duplexes (bottom left) with GG(T/C)G sites in bold and m CpG sites underlined. Electrophoretic mobility shift assays (bottom right) with 0–6 µM DBD and 1 µM DNA (NANK or NANKm) were stained with EtBr (red) for two independent replicates. b DBD contacts with the NKA dodecamer. (Top) DBD sequence and secondary structure for ZnF1 (magenta), ZnF2 (cyan) and ZnF3 (red). (Bottom) NKA sequence numbered 5′-to-3’; GGTG motif in cyan. DBD residues that contact DNA bases are highlighted in yellow; numerals −1, 2, 3, or 6 refer to the canonical C2H2 recognition code . Solid (or dotted) vertical lines indicate hydrogen bonds (or van der Waals contacts). c Crystal structure of DBD bound to the NKA dodecamer (middle) and close-up views (sides) with 2F o –F c electron density maps contoured at 1.0 σ. Three ZnFs, colored as in ( b ), wrap around the DNA (gray) with zinc ions as blue spheres, residues and bases colored by atom type (carbon, black; nitrogen, blue; oxygen, red), hydrogen bonds as black dotted lines, and van der Waals contact distances marked with black arrows. d Superposition of DBD:NKA complex (same colors as above) and a previous DBD:DNA complex (PDB ID: 2wbs, black) shown in two views related by a 90° rotation. ZnF1 in 2wbs is rotated away from the DNA axis compared to our complex (arrow).

Article Snippet: The KLF4 coding regions corresponding to the intrinsically disordered region (IDR, residues 2-417) or the DNA binding domain (DBD, residues 418–513) were amplified from the plasmid encoding human KLF4 gene (GeneArt) using primer sets KLF4-2F/KLF4-2R or KLF4-3F/KLF4-3R, respectively, and ligated into Bam HI/ Kpn I-digested pHRT-mTu-AH lentiviral transfer vector using Gibson Assembly Master Mix. pHRT-KLF4_R501A-mTu-AH.

Techniques: Electrophoretic Mobility Shift Assay, Staining, Sequencing

Journal: Nature Communications

Article Title: Liquid condensation of reprogramming factor KLF4 with DNA provides a mechanism for chromatin organization

doi: 10.1038/s41467-021-25761-7

Figure Lengend Snippet: a Consensus KLF4 binding site from JASPAR and schematic DBD contacts (left); mapping these sites and contacts onto the NANK sequence (right); in each 9 bp site (yellow), bases that match the consensus are in bold. b Posing DBD:NKA at cognate sites KLFB/KLFC (left) or KLFA/KLFC (right) on B-DNA NANK model generates no clashes. c B-DNA NANK model with canonical DBDs at KLFA and KLFC shown as surfaces and two poses for DBD at KLFB in cartoons. ZnF1 of DBD:NKA (yellow) clashes with DBD modeled at KLFA (top right) but an alternate ZnF1 pose (2wbs, red) does not. Positions of key residue:base contacts indicated in cyan. d Distances between modeled NANK 5′ ends and H446 Cα of ZnF1 sterically excluded from KLFA (left) or KLFB (right) favor 5′ labeling the coding strand. e Superimposing a second duplex on the excluded ZnFs suggests that 5′ labels could be used to detect DBD-mediated DNA bridging in solution by smFRET. f FRET efficiency ( E FRET ) histograms of mixtures of 100 pM Alexa 488-labeled NANK and 500 pM Alexa 594-labeled NANK in the absence (left) or presence (right) of 1 μM KLF4 DBD were fit to Gaussian functions (donor emission, green; acceptor/FRET emission, red). Bottom schematic emphasizes that the atomic details of DNA:DBD:DNA bridging are not defined experimentally.

Article Snippet: The KLF4 coding regions corresponding to the intrinsically disordered region (IDR, residues 2-417) or the DNA binding domain (DBD, residues 418–513) were amplified from the plasmid encoding human KLF4 gene (GeneArt) using primer sets KLF4-2F/KLF4-2R or KLF4-3F/KLF4-3R, respectively, and ligated into Bam HI/ Kpn I-digested pHRT-mTu-AH lentiviral transfer vector using Gibson Assembly Master Mix. pHRT-KLF4_R501A-mTu-AH.

Techniques: Binding Assay, Sequencing, Residue, Labeling

Journal: Nature Communications

Article Title: Liquid condensation of reprogramming factor KLF4 with DNA provides a mechanism for chromatin organization

doi: 10.1038/s41467-021-25761-7

Figure Lengend Snippet: a Fluorescence microscopy images of 3 µM duplex DNA in TS buffer and 100 nM YOYO-1 with (bottom) or without (top) 10 µM DBD. Similar results were obtained for 2 replicates. b Fluorescence microscopy images of DBD:DNA mixtures at 3:1 and 3:1.5 ratios show that adding cognate DNA can reverse LLPS. Similar results were obtained for 2 replicates. c Mixing DBD and DNAs at different concentrations produces condensates (black circles) or homogeneous solutions (open circles) that define LLPS phase diagrams. Images were scored as condensate if the coefficient of variation was >0.2 and the mean fluorescent intensity was >0.4 arbitrary units. Values were determined using ImageJ from 2–3 independent replicates. Fluorescence images at right are taken at 3 µM DBD and 250 nM DNA, conditions boxed in red in the phase diagrams. d LLPS phase diagrams determined as in ( c ) but for double mutant DBD E476D/R501A with DNAs. e Fluorescence images of HEK 293T cells expressing KLF4-mTurq (left), KLF4 R501A -mTurq (middle) and KLF4 E476D/R501A -mTurq (right). Bottom row shows close-ups of single cells with the same mean fluorescence (~5000 AU). Similar results were obtained for 2 biological replicates. f HEK 293T cells expressing KLF4-mTurq variants classified as diffuse (gray, left) or punctate (red) are plotted by mean fluorescence intensity; the long horizontal bars mark the median, and the top and bottom bars on the vertical lines denote the 90-10 percentiles. Wildtype “diffuse” cells show lower fluorescence than those cells expressing KLF4 R501A -mTurq or KLF4 E476D/R501A -mTurq ( n = 112 diffuse cells for each fusion across 2 biological replicates). Cells with at least 5 distinct puncta (0.5 µm spots with intensity center >1500 arbitrary units, determined using Imaris software) were classified as punctate. Statistical tests were performed using a two-sided Student’s paired t -test. Y -axis limit was set to 30,000 for visualization purposes. Fields that yielded 112 diffuse cells also gave punctate cell counts of 209 (WT), 39 (KLF4 R501A -mTurq) and 64 (KLF4 E476D/R501A -mTurq) across 2 biological replicates.

Article Snippet: The KLF4 coding regions corresponding to the intrinsically disordered region (IDR, residues 2-417) or the DNA binding domain (DBD, residues 418–513) were amplified from the plasmid encoding human KLF4 gene (GeneArt) using primer sets KLF4-2F/KLF4-2R or KLF4-3F/KLF4-3R, respectively, and ligated into Bam HI/ Kpn I-digested pHRT-mTu-AH lentiviral transfer vector using Gibson Assembly Master Mix. pHRT-KLF4_R501A-mTu-AH.

Techniques: Fluorescence, Microscopy, Mutagenesis, Expressing, Software

Journal: Nature Communications

Article Title: Liquid condensation of reprogramming factor KLF4 with DNA provides a mechanism for chromatin organization

doi: 10.1038/s41467-021-25761-7

Figure Lengend Snippet: a Fluorescence microscopy images of HEK 293T cells expressing OCT4-mCherry (left) or SOX2-mCherry (right). Some SOX2-mCherry distributions suggest mitotic bookmarking (white arrow). b Fluorescence microscopy images of HEK 293T cells. Screening ~1000 cells from 2 transfection replicates identified 73 cells that co-express OCT4-mCherry and KLF4-mTurq; all 73 show tags colocalized to droplets (examples top and bottom). c Fluorescence microscopy images of HEK 293T cells. Screening ~1000 cells from 2 transfection replicates identified 39 cells that co-express SOX2-mCherry and KLF4-mTurq; 29 cells show tags colocalized to droplets (example, top row) and 10 cells do not (example, bottom row). d Fluorescence microscopy images of 1.5 µM NANK DNA with 100 nM YOYO-1 and 50 nM OCT4-AF647 (top) or 70 nM SOX2-AF647 (bottom) without (left column) or with (right three columns) 9 µM DBD. Similar results were obtained for 2 replicates. e Fluorescence microscopy images of polynucleosomes (green; 20 ng DNA/µl, Active Motif, Inc., visualized with 100 nM YOYO-1) with 10 µM DBD (red; trace labeled 1:100 with DBD-AF594). Similar results were obtained for 2 replicates. f Fluorescence microscopy images of polynucleosomes (green; 11 ng DNA/µl, visualized with 100 nM YOYO-1) with OCT4-AF647 (50 nM; purple, top row) or SOX2-AF647 (70 nM; purple, bottom row) alone (left) or with 1 µM DBD (three right panels). Similar results were obtained for 2 replicates. g Longer DNAs undergo LLPS with DBD at low concentrations. Fluorescence images of DBD with 30 bp NANK, 404 bp NP ( NANOG promoter), 7.4 kbp NPE ( NANOG promoter enhancer) and 5 kbp plasmid DNA in nucleosomes (left to right panels, respectively). Conditions: DBD (250 nM) mixed with different DNA (mass equivalent of 0.6 ng/µl; 32 nM NANK or 2.5 nM NP or 140 pM NPE or 210 pM plasmid DNA concentration in nucleosomes) in TS buffer with 100 nM YOYO-1. Similar results were obtained for 2 replicates.

Article Snippet: The KLF4 coding regions corresponding to the intrinsically disordered region (IDR, residues 2-417) or the DNA binding domain (DBD, residues 418–513) were amplified from the plasmid encoding human KLF4 gene (GeneArt) using primer sets KLF4-2F/KLF4-2R or KLF4-3F/KLF4-3R, respectively, and ligated into Bam HI/ Kpn I-digested pHRT-mTu-AH lentiviral transfer vector using Gibson Assembly Master Mix. pHRT-KLF4_R501A-mTu-AH.

Techniques: Fluorescence, Microscopy, Expressing, Transfection, Labeling, Plasmid Preparation, Concentration Assay

Journal: Nature Communications

Article Title: Liquid condensation of reprogramming factor KLF4 with DNA provides a mechanism for chromatin organization

doi: 10.1038/s41467-021-25761-7

Figure Lengend Snippet: a KLF4 levels rise early in reprogramming, leading to KLF4 biomolecular condensation. b – g Proposed roles for KLF4:DNA condensates in chromatin reorganization during reprogramming. b Pluripotency-related sites in closed chromatin of somatic cells lack KLF4. c Sites will recruit KLF4 and form local KLF4:DNA condensates as expression levels rise. d Random diffusive encounters of cis-acting elements leads to fusion of their condensates and persistent colocalization. e Loci on different chromosomes can also be co-localized in KLF4:DNA condensates. f , g Within the condensate, KLF4 makes DNA bridging contacts at cognate 9 bp KLF4 sites (yellow), especially where such sites overlap, but perhaps also at 6 bp partial sites or non-cognate sites. The KLF4:DNA condensate enriches TFs relative to solution, helping to saturate binding sites for TFs OCT4 and SOX2 and to recruit co-activators such as CBP/p300 to activate NANOG expression and gain access to pluripotency.

Article Snippet: The KLF4 coding regions corresponding to the intrinsically disordered region (IDR, residues 2-417) or the DNA binding domain (DBD, residues 418–513) were amplified from the plasmid encoding human KLF4 gene (GeneArt) using primer sets KLF4-2F/KLF4-2R or KLF4-3F/KLF4-3R, respectively, and ligated into Bam HI/ Kpn I-digested pHRT-mTu-AH lentiviral transfer vector using Gibson Assembly Master Mix. pHRT-KLF4_R501A-mTu-AH.

Techniques: Expressing, Binding Assay

Journal:

Article Title: Genetic and Functional Diversity of Human Immunodeficiency Virus Type 1 Subtype B Nef Primary Isolates

doi: 10.1128/JVI.75.4.1672-1680.2001

Figure Lengend Snippet: Seven primary isolate nef genes and D. con nef were stably expressed in CEM cells. The function of these Nefs in CD4 and MHC class I downregulation and activation of PAK-2 was determined. The level of expression for each Nef was determined by Western blot analysis. (A) Two-color analysis for CD4 (PE) and MHC class I (FITC) cell surface expression in transduced CEM cells was determined by fluorescence-activated cell sorter (FACS) analysis. (Top left) CEM LXSN cells (negative control). (Top right) CEM LXSN cells (positive control). (B) Western blot analysis of Nef expression in extracts from transduced CEM cells. Control, CEM LXSN cell extracts. (C) Activation of p21-activated protein kinase-2 (Pak2) by Nef was assayed with extracts from transduced CEM cells. Control, CEM LXSN cell extracts. We have reported 233 Nef to be expressed at near the same level as SF2 Nef with a rabbit anti-Nef serum (36). The apparent reduced expression of 233 Nef in Fig. ​Fig.2B2B seems to result from a reduced immunoreactivity of 233 Nef to the sheep anti-SF2 Nef serum used for these studies. A similar observation was made for NefEE155QQ in reference 2.

Article Snippet: For analysis of cell surface CD4 and MHC class I levels, transduced CEM cells (5 × 10 5 ) were first incubated with mouse monoclonal anti-haplotype A1, A11, and A26 MHC class I antibody (One Lambda) for 20 min on ice, and then the cells were washed twice in 2 ml of ice-cold phosphate-buffered saline containing 5% calf serum and 0.1% NaN 3 .

Techniques: Stable Transfection, Activation Assay, Expressing, Western Blot, Fluorescence, Negative Control, Positive Control

Journal:

Article Title: Genetic and Functional Diversity of Human Immunodeficiency Virus Type 1 Subtype B Nef Primary Isolates

doi: 10.1128/JVI.75.4.1672-1680.2001

Figure Lengend Snippet: The effect of D90-1 derived mutations, A29V and A158V, on D.con Nef function in CEM cells was determined. Two-color analysis for CD4 (PE) and MHC class I (FITC) cell surface expression in transduced CEM cells was determined by FACS. (Top left) CEM LXSN cells (negative control). (Top right) CEM LXSN cells (positive control).

Article Snippet: For analysis of cell surface CD4 and MHC class I levels, transduced CEM cells (5 × 10 5 ) were first incubated with mouse monoclonal anti-haplotype A1, A11, and A26 MHC class I antibody (One Lambda) for 20 min on ice, and then the cells were washed twice in 2 ml of ice-cold phosphate-buffered saline containing 5% calf serum and 0.1% NaN 3 .

Techniques: Derivative Assay, Expressing, Negative Control, Positive Control

Journal:

Article Title: Genetic and Functional Diversity of Human Immunodeficiency Virus Type 1 Subtype B Nef Primary Isolates

doi: 10.1128/JVI.75.4.1672-1680.2001

Figure Lengend Snippet: The effects of mutations of S189R and F193I on D.con Nef function and R189S on D88-11 Nef function in CEM cells were determined. (A) Two-color analysis for CD4 (PE) and MHC class I (FITC) cell surface expression in transduced CEM cells was determined by FACS. (Top left) CEM LXSN cells (negative control). (Top right) CEM LXSN cells (positive control). (B) Western blot analysis of Nef expression in extracts from transduced CEM cells. Control, CEM LXSN cell extracts. (C) Activation of p21-activated protein kinase-2 (Pak2) by Nef was assayed with extracts from transduced CEM cells. Control, CEM LXSN cell extracts.

Article Snippet: For analysis of cell surface CD4 and MHC class I levels, transduced CEM cells (5 × 10 5 ) were first incubated with mouse monoclonal anti-haplotype A1, A11, and A26 MHC class I antibody (One Lambda) for 20 min on ice, and then the cells were washed twice in 2 ml of ice-cold phosphate-buffered saline containing 5% calf serum and 0.1% NaN 3 .

Techniques: Expressing, Negative Control, Positive Control, Western Blot, Activation Assay

Journal:

Article Title: Genetic and Functional Diversity of Human Immunodeficiency Virus Type 1 Subtype B Nef Primary Isolates

doi: 10.1128/JVI.75.4.1672-1680.2001

Figure Lengend Snippet: Summary of Nef point mutations and their associated phenotypes a

Article Snippet: For analysis of cell surface CD4 and MHC class I levels, transduced CEM cells (5 × 10 5 ) were first incubated with mouse monoclonal anti-haplotype A1, A11, and A26 MHC class I antibody (One Lambda) for 20 min on ice, and then the cells were washed twice in 2 ml of ice-cold phosphate-buffered saline containing 5% calf serum and 0.1% NaN 3 .

Techniques: Activation Assay

Journal: eLife

Article Title: Inhibition of DNMT1 methyltransferase activity via glucose-regulated O-GlcNAcylation alters the epigenome

doi: 10.7554/elife.85595

Figure Lengend Snippet: Figure 1. High glucose increases O-GlcNAcylation of DNMT1 in cell lines and primary cells. (A) Hep3B cells were treated with glucose (5 mM or 25 mM) with or without Thiamet-G (TMG). Shown are immunoblots of collected lysates using antibody targeting O-GlcNAc and GAPDH (n = 3). (B) Lysates of Hep3B treated with glucose were immunoprecipitated with DNMT1 and immunoprecipitates were immunoblotted with antibody targeting O-GlcNAc (n = 3). (C) Peripheral blood mononuclear cells (PBMCs) were isolated from three individual donor blood samples and treated with increasing concentration of glucose for 24 hr. Collected cell lysates from PBMCs were immunoprecipitated with antibody targeting DNMT1 and immunoblotted for O-GlcNAc. Representative blot from one donor (n = 3). (D) Immunoblots for O-GlcNAc and GAPDH from liver samples of C57BL/6J mice given a high- fat/high-sucrose diet (HF/HS) or normal diet (chow) for 4 mo, and immunoprecipitated with Dnmt1. Lysates of mouse liver were immunoprecipitated with Dnmt1 and immunoprecipitates were immunoblotted with antibody targeting O-GlcNAc. *p<0.001; **p<0.0005; ***p<0.0001 by Student’s t-test (A-D); ns, not significant; data are represented as mean ± SD from three replicates of each sample.

Article Snippet: Reagent type (species) or resource Designation Source or reference Identifiers Additional information Gene (Homo sapiens) DNMT1 HUGO Gene Nomenclature Committee HGNC:2976 - Cell line (H. sapiens) Hep 3B2.1–7 ATCC HB- 8064 - Cell line (H. sapiens) Hep G2 ATCC HB- 8065 - Transfected construct (H. sapiens) pcDNA3/Myc- DNMT1 Addgene Plasmid #36939 Antibody Anti- beta- actin (D6A8) (rabbit monoclonal) Cell Signaling Technology Cat# 8457 WB (1:1000) Antibody Anti- alpha- tubulin (11H10) (rabbit monoclonal) Cell Signaling Technology Cat# 2125 WB (1:1000) Antibody Anti- DNMT1 (60B1220.1) (mouse monoclonal) Novus Biologicals Cat# NB100- 56519 IP (1:250) WB (1:1000) Antibody Anti- DNMT1 (H- 12) (mouse monoclonal) Santa Cruz Biotechnology Cat# sc- 271729 WB (1:1000) Antibody Anti- gamma H2A.X (rabbit polyclonal) Abcam Cat# ab11174 IF (1:1000) Antibody Anti- GAPDH (rabbit monoclonal) Abcam Cat# ab181602 WB (1:1000) Antibody Anti- H3 (rabbit polyclonal) Abcam Cat# ab1791 WB (1:1000) Antibody Anti- Myc [Myc.A7] (mouse monoclonal) Abcam Cat# ab18185 IP (1:250) WB (1:1000) Antibody Anti- O- GlcNAc (RL2) (mouse monoclonal) Abcam Cat# ab2739 WB (1:1000) Antibody Aoat anti- rabbit IgG H&L (HRP) (goat polyclonal) Abcam Cat# ab6721 WB (1:5000) Antibody Goat anti- mouse IgG H&L (HRP) (goat polyclonal) Abcam Cat# ab6789 WB (1:5000) Antibody Goat anti- mouse IgG (H+L), Alexa 488 (goat polyclonal) Invitrogen Cat# A32723 WB (1:1000) Sequence- based reagent DNMT1- T158A This paper PCR primers agccccaggatt CGA aggaaaagcacc Sequence- based reagent DNMT1- T158A This paper PCR primers ggtgcttttcct TCG aatcctggggct Sequence- based reagent DNMT1- T616A This paper PCR primers gacaggggaccc GCG aaagccaccacc Sequence- based reagent DNMT1- T616A This paper PCR primers ggtggtggcttt CGC gggtcccctgtc Sequence- based reagent DNMT1- S878A This paper PCR primers gcgagattcgag GAG cctccaaaaacc Sequence- based reagent DNMT1- S878A This paper PCR primers ggtttttggagg CTC ctcgaatctcgc Sequence- based reagent DNMT1- S878D This paper PCR primers gcgagattcgag GAC cctccaaaaacc Sequence- based reagent DNMT1- S878D This paper PCR primers ggtttttggagg GTC ctcgaatctcgc Sequence- based reagent DNMT1- T882A This paper PCR primers tcccctccaaaa GCC cagccaacagag Sequence- based reagent DNMT1- T882A This paper PCR primers ctctgttggctg GGC ttttggagggga Commercial assay or kit Q5 Site- Directed Mutagenesis kit NEB Cat# E0554S - Shin et al. eLife 2023;12:e85595.

Techniques: Western Blot, Immunoprecipitation, Isolation, Concentration Assay

Journal: eLife

Article Title: Inhibition of DNMT1 methyltransferase activity via glucose-regulated O-GlcNAcylation alters the epigenome

doi: 10.7554/elife.85595

Figure Lengend Snippet: Figure 2. Identification of O-GlcNAcylated sites within DNMT1 by LC-MS/MS. (A) Schematic drawing of the DNMT1 O-GlcNAc-modified region enriched from Hep3B cells based on mass spectrometry (MS) data and tandem MS (MS/MS) peaks. FTMS+ p NSI full MS (400.0000–1600.0000). DQDYARFESPPKTQPTEDNKF (S9 HexNAc) – S878. (B) Schematic diagram of identified novel O-GlcNAcylated and phosphorylated sites within DNMT1 as determined via LC-MS/MS. DMAP, DNA methyltransferase associated protein-binding domain; PCNA, proliferating cell nuclear antigen-binding domain; NLS, nuclear localization sequences; RFTS, replication foci targeting sequence domain; BAH, bromo-adjacent homology domain. (C) Sequence conservation of S878 in vertebrates. (D) Each immunoprecipitated Myc-DNMT1 wild type and substituted mutants was immunoblotted with an O- GlcNAc antibody (n = 3). **p<0.0005; ***p<0.0001 by Student’s t-test (D); N.D., not detected, ns, not significant; data are represented as mean ± SD from three replicates of each sample.

Article Snippet: Reagent type (species) or resource Designation Source or reference Identifiers Additional information Gene (Homo sapiens) DNMT1 HUGO Gene Nomenclature Committee HGNC:2976 - Cell line (H. sapiens) Hep 3B2.1–7 ATCC HB- 8064 - Cell line (H. sapiens) Hep G2 ATCC HB- 8065 - Transfected construct (H. sapiens) pcDNA3/Myc- DNMT1 Addgene Plasmid #36939 Antibody Anti- beta- actin (D6A8) (rabbit monoclonal) Cell Signaling Technology Cat# 8457 WB (1:1000) Antibody Anti- alpha- tubulin (11H10) (rabbit monoclonal) Cell Signaling Technology Cat# 2125 WB (1:1000) Antibody Anti- DNMT1 (60B1220.1) (mouse monoclonal) Novus Biologicals Cat# NB100- 56519 IP (1:250) WB (1:1000) Antibody Anti- DNMT1 (H- 12) (mouse monoclonal) Santa Cruz Biotechnology Cat# sc- 271729 WB (1:1000) Antibody Anti- gamma H2A.X (rabbit polyclonal) Abcam Cat# ab11174 IF (1:1000) Antibody Anti- GAPDH (rabbit monoclonal) Abcam Cat# ab181602 WB (1:1000) Antibody Anti- H3 (rabbit polyclonal) Abcam Cat# ab1791 WB (1:1000) Antibody Anti- Myc [Myc.A7] (mouse monoclonal) Abcam Cat# ab18185 IP (1:250) WB (1:1000) Antibody Anti- O- GlcNAc (RL2) (mouse monoclonal) Abcam Cat# ab2739 WB (1:1000) Antibody Aoat anti- rabbit IgG H&L (HRP) (goat polyclonal) Abcam Cat# ab6721 WB (1:5000) Antibody Goat anti- mouse IgG H&L (HRP) (goat polyclonal) Abcam Cat# ab6789 WB (1:5000) Antibody Goat anti- mouse IgG (H+L), Alexa 488 (goat polyclonal) Invitrogen Cat# A32723 WB (1:1000) Sequence- based reagent DNMT1- T158A This paper PCR primers agccccaggatt CGA aggaaaagcacc Sequence- based reagent DNMT1- T158A This paper PCR primers ggtgcttttcct TCG aatcctggggct Sequence- based reagent DNMT1- T616A This paper PCR primers gacaggggaccc GCG aaagccaccacc Sequence- based reagent DNMT1- T616A This paper PCR primers ggtggtggcttt CGC gggtcccctgtc Sequence- based reagent DNMT1- S878A This paper PCR primers gcgagattcgag GAG cctccaaaaacc Sequence- based reagent DNMT1- S878A This paper PCR primers ggtttttggagg CTC ctcgaatctcgc Sequence- based reagent DNMT1- S878D This paper PCR primers gcgagattcgag GAC cctccaaaaacc Sequence- based reagent DNMT1- S878D This paper PCR primers ggtttttggagg GTC ctcgaatctcgc Sequence- based reagent DNMT1- T882A This paper PCR primers tcccctccaaaa GCC cagccaacagag Sequence- based reagent DNMT1- T882A This paper PCR primers ctctgttggctg GGC ttttggagggga Commercial assay or kit Q5 Site- Directed Mutagenesis kit NEB Cat# E0554S - Shin et al. eLife 2023;12:e85595.

Techniques: Liquid Chromatography with Mass Spectroscopy, Modification, Mass Spectrometry, Tandem Mass Spectroscopy, Protein Binding, Binding Assay, Sequencing, Immunoprecipitation

Journal: eLife

Article Title: Inhibition of DNMT1 methyltransferase activity via glucose-regulated O-GlcNAcylation alters the epigenome

doi: 10.7554/elife.85595

Figure Lengend Snippet: Figure 4. High glucose leads to loss of DNA methylation at cancer-specific partially methylated domains (PMDs). (A) Density plot of DNA methylation for DNMT1-WT and DNMT1-S878A cells with either low (5 mM, CTRL) or high glucose/Thiamet-G (TMG) (25 mM, O-GlcNAc). (B) Genome browser screenshot of DNA methylation for DNMT1-WT and DNMT1-S878A cells and low or high glucose along with liver tumor PMDs from Li et al., 2016. (C) Boxplots of DNA methylation at PMDs or general genomic background (BG) for each DNMT1-WT and DNMT1-S878A treated with low (5 mM, CTRL) or high glucose/TMG (25 mM, O-GlcNAc). (D) Heatmap representation of global DNA methylation for DNMT1-WT and DNMT1-S878A cells under low (5 mM, CTRL) or high glucose/TMG (25 mM, O-GlcNAc) at gene-poor and gene-rich regions. (E) Methylation changes from O-GlcNAcylation of DNMT1 by wave score for replication timing (Hansen et al., 2010; Thurman et al., 2007). ***p<0.0001 by Wilcoxon signed-rank test (C).

Article Snippet: Reagent type (species) or resource Designation Source or reference Identifiers Additional information Gene (Homo sapiens) DNMT1 HUGO Gene Nomenclature Committee HGNC:2976 - Cell line (H. sapiens) Hep 3B2.1–7 ATCC HB- 8064 - Cell line (H. sapiens) Hep G2 ATCC HB- 8065 - Transfected construct (H. sapiens) pcDNA3/Myc- DNMT1 Addgene Plasmid #36939 Antibody Anti- beta- actin (D6A8) (rabbit monoclonal) Cell Signaling Technology Cat# 8457 WB (1:1000) Antibody Anti- alpha- tubulin (11H10) (rabbit monoclonal) Cell Signaling Technology Cat# 2125 WB (1:1000) Antibody Anti- DNMT1 (60B1220.1) (mouse monoclonal) Novus Biologicals Cat# NB100- 56519 IP (1:250) WB (1:1000) Antibody Anti- DNMT1 (H- 12) (mouse monoclonal) Santa Cruz Biotechnology Cat# sc- 271729 WB (1:1000) Antibody Anti- gamma H2A.X (rabbit polyclonal) Abcam Cat# ab11174 IF (1:1000) Antibody Anti- GAPDH (rabbit monoclonal) Abcam Cat# ab181602 WB (1:1000) Antibody Anti- H3 (rabbit polyclonal) Abcam Cat# ab1791 WB (1:1000) Antibody Anti- Myc [Myc.A7] (mouse monoclonal) Abcam Cat# ab18185 IP (1:250) WB (1:1000) Antibody Anti- O- GlcNAc (RL2) (mouse monoclonal) Abcam Cat# ab2739 WB (1:1000) Antibody Aoat anti- rabbit IgG H&L (HRP) (goat polyclonal) Abcam Cat# ab6721 WB (1:5000) Antibody Goat anti- mouse IgG H&L (HRP) (goat polyclonal) Abcam Cat# ab6789 WB (1:5000) Antibody Goat anti- mouse IgG (H+L), Alexa 488 (goat polyclonal) Invitrogen Cat# A32723 WB (1:1000) Sequence- based reagent DNMT1- T158A This paper PCR primers agccccaggatt CGA aggaaaagcacc Sequence- based reagent DNMT1- T158A This paper PCR primers ggtgcttttcct TCG aatcctggggct Sequence- based reagent DNMT1- T616A This paper PCR primers gacaggggaccc GCG aaagccaccacc Sequence- based reagent DNMT1- T616A This paper PCR primers ggtggtggcttt CGC gggtcccctgtc Sequence- based reagent DNMT1- S878A This paper PCR primers gcgagattcgag GAG cctccaaaaacc Sequence- based reagent DNMT1- S878A This paper PCR primers ggtttttggagg CTC ctcgaatctcgc Sequence- based reagent DNMT1- S878D This paper PCR primers gcgagattcgag GAC cctccaaaaacc Sequence- based reagent DNMT1- S878D This paper PCR primers ggtttttggagg GTC ctcgaatctcgc Sequence- based reagent DNMT1- T882A This paper PCR primers tcccctccaaaa GCC cagccaacagag Sequence- based reagent DNMT1- T882A This paper PCR primers ctctgttggctg GGC ttttggagggga Commercial assay or kit Q5 Site- Directed Mutagenesis kit NEB Cat# E0554S - Shin et al. eLife 2023;12:e85595.

Techniques: DNA Methylation Assay, Methylation

Journal: eLife

Article Title: Inhibition of DNMT1 methyltransferase activity via glucose-regulated O-GlcNAcylation alters the epigenome

doi: 10.7554/elife.85595

Figure Lengend Snippet: Figure 5. High glucose-induced reactive oxygen species (ROS) and DNA damage cause apoptotic cell death in DNMT1-WT cells. (A) Quantitative fluorescence image of ROS in DNMT1-WT and DNMT1-S878A cells with either low (5 mM, CTRL) or high glucose/Thiamet-G (TMG) (25 mM, O-GlcNAc). (B) Quantitative fluorescence image of γ-H2A.X in DNMT1-WT and DNMT1-S878A cells treated with low (5 mM, CTRL) or high glucose/TMG (25 mM, O- GlcNAc). (C) Quantitative fluorescence image of cell death in propidium iodide staining of DNMT1-WT and DNMT1-S878A cells under low (5 mM, CTRL) or high glucose/TMG (25 mM, O-GlcNAc). *p<0.001; **p<0.0005; ***p<0.0001 by Student’s t-test (A–C); data are represented as mean ± SD from three replicates of each sample.

Article Snippet: Reagent type (species) or resource Designation Source or reference Identifiers Additional information Gene (Homo sapiens) DNMT1 HUGO Gene Nomenclature Committee HGNC:2976 - Cell line (H. sapiens) Hep 3B2.1–7 ATCC HB- 8064 - Cell line (H. sapiens) Hep G2 ATCC HB- 8065 - Transfected construct (H. sapiens) pcDNA3/Myc- DNMT1 Addgene Plasmid #36939 Antibody Anti- beta- actin (D6A8) (rabbit monoclonal) Cell Signaling Technology Cat# 8457 WB (1:1000) Antibody Anti- alpha- tubulin (11H10) (rabbit monoclonal) Cell Signaling Technology Cat# 2125 WB (1:1000) Antibody Anti- DNMT1 (60B1220.1) (mouse monoclonal) Novus Biologicals Cat# NB100- 56519 IP (1:250) WB (1:1000) Antibody Anti- DNMT1 (H- 12) (mouse monoclonal) Santa Cruz Biotechnology Cat# sc- 271729 WB (1:1000) Antibody Anti- gamma H2A.X (rabbit polyclonal) Abcam Cat# ab11174 IF (1:1000) Antibody Anti- GAPDH (rabbit monoclonal) Abcam Cat# ab181602 WB (1:1000) Antibody Anti- H3 (rabbit polyclonal) Abcam Cat# ab1791 WB (1:1000) Antibody Anti- Myc [Myc.A7] (mouse monoclonal) Abcam Cat# ab18185 IP (1:250) WB (1:1000) Antibody Anti- O- GlcNAc (RL2) (mouse monoclonal) Abcam Cat# ab2739 WB (1:1000) Antibody Aoat anti- rabbit IgG H&L (HRP) (goat polyclonal) Abcam Cat# ab6721 WB (1:5000) Antibody Goat anti- mouse IgG H&L (HRP) (goat polyclonal) Abcam Cat# ab6789 WB (1:5000) Antibody Goat anti- mouse IgG (H+L), Alexa 488 (goat polyclonal) Invitrogen Cat# A32723 WB (1:1000) Sequence- based reagent DNMT1- T158A This paper PCR primers agccccaggatt CGA aggaaaagcacc Sequence- based reagent DNMT1- T158A This paper PCR primers ggtgcttttcct TCG aatcctggggct Sequence- based reagent DNMT1- T616A This paper PCR primers gacaggggaccc GCG aaagccaccacc Sequence- based reagent DNMT1- T616A This paper PCR primers ggtggtggcttt CGC gggtcccctgtc Sequence- based reagent DNMT1- S878A This paper PCR primers gcgagattcgag GAG cctccaaaaacc Sequence- based reagent DNMT1- S878A This paper PCR primers ggtttttggagg CTC ctcgaatctcgc Sequence- based reagent DNMT1- S878D This paper PCR primers gcgagattcgag GAC cctccaaaaacc Sequence- based reagent DNMT1- S878D This paper PCR primers ggtttttggagg GTC ctcgaatctcgc Sequence- based reagent DNMT1- T882A This paper PCR primers tcccctccaaaa GCC cagccaacagag Sequence- based reagent DNMT1- T882A This paper PCR primers ctctgttggctg GGC ttttggagggga Commercial assay or kit Q5 Site- Directed Mutagenesis kit NEB Cat# E0554S - Shin et al. eLife 2023;12:e85595.

Techniques: Fluorescence, Staining

Journal: bioRxiv

Article Title: MAFB surrogates the glucocorticoid receptor ability to induce tolerogenesis in dendritic cells

doi: 10.1101/2021.07.27.453975

Figure Lengend Snippet: (A) Schematic representation of the experimental approach, comparing dendritic cell (DC) with tolerogenic dendritic cell (tolDC) differentiation. (B) DC and tolDC were cocultured with CD8+ cells for 5 days. The final CFSE signal of CD8+ cells is shown (left panel). CD8+ with only CD3/CD28 T-activator beads (C+) or alone (C-) are also shown. In the right panel, the average proliferation of the quadruplicate is shown (mean ± standard error of the mean (SEM)). (C) IL-10, TNFα, IL-12p70 and IL1-β production of DC and tolDC, after 5 days of differentiation and 24 h of LPS (10 ng/μL) and IFNg (20 ng/μL) stimuli. P-values of paired t-tests are shown. (D) Box-plots of CD80, CD83, CD86 and HLA-DR surface expression (Median Fluorescence Intensity) in DCs and tolDCs in steady-state or stimulated with LPS (10 ng/μL) and IFNg (20 ng/μL) (ns p > 0.05, ** p < 0.01, *** p ≤ 0.001). (E) Gene expression heatmap of differentially expressed genes comparing tolDCs with DCs and also displaying the gene expression values of the precursor cell type (MO) (logFC > 0.5, FDR < 0.05). Scaled fluorescence values of expression arrays are shown, ranging from -2 (lower gene expression, green) to +2 (higher gene expression, orange). (F) Gene ontology (GO) over-representation of GO Biological Process categories. Fold change of tolDC induced genes over background and -log10(FDR) of Fisher’s exact tests are shown. (G) Discriminant regulon expression analysis (DoRothEA) of tolDC compared with DC. Only transcription factors with FDR < 0.05 are shown. NES and logFC of transcription factor expression are depicted. (H) T-distributed stochastic neighbor embedding (t-SNE) plot of the aggregated and batch-corrected gene expression data from our study (MO, DC and tolDC) and two additional public datasets (GSE40484 (moMAC, moDC, cDC2, CM (Classical MOs) and NCM (Non-Classical MOs) and GSE99056 (M-MAC (M2 Macrophages) and GM-MAC (M1 Macrophages)). The 4 different groups obtained using k-means clustering are represented with grey ellipses of multivariate t-distributions.

Article Snippet: Enzyme-linked immunosorbent assays (ELISA) were performed, following the manufacturer’s instructions: Human IL-10, Human IL-12p70, and Human TNFα from BioLegend, and Human IL-1β from ThermoFisher.

Techniques: Expressing, Fluorescence, Gene Expression

Journal: bioRxiv

Article Title: MAFB surrogates the glucocorticoid receptor ability to induce tolerogenesis in dendritic cells

doi: 10.1101/2021.07.27.453975

Figure Lengend Snippet: (A) Volcano plot comparing tolDCs treated with control siRNA (siCTL) and MAFB siRNA (siMAFB). Dashed lines indicate significance thresholds (FDR < 0.05, absolute logFC > 0.5). tolDC-induced and tolDC-repressed genes are shown in blue and orange, respectively. (B) Gene set enrichment analysis (GSEA) of tolDCs (siCTL) vs. tolDCs (siMAFB), using tolDC-induced and tolDC-repressed gene sets. The running enrichment score is represented and the normalized enrichment score (NES) is shown above (FDR < 0.01). (C) DNA methylation heatmap of previously obtained differentially methylated CpGs (C1-CpGs and C2-CpGs) in tolDCs (siCTL) and tolDCs (siMAFB). Scaled β-values are shown (lower DNA methylation levels in blue and higher methylation levels in red). On the right side, violin plots of Cluster 1 (C1) and Cluster 2 (C2) depict β-values (ns p > 0.05, *** p ≤ 0.001). (D) Methylated CpG set enrichment analysis (mCSEA) of tolDCs (siCTL) vs. tolDCs (siMAFB), using MAFB-only CpGs, GR/MAFB CpGs and GR-only CpGs as CpG-sets (depending on the overlap of CpGs with GR or MAFB peaks). The running enrichment score is represented and the normalized enrichment score (NES) and FDR are shown above. (E) Box-plots of median fluorescence intensity (MFI) of CD14, CD16, CD163 and CD1a flow cytometry data from DCs (siCTL), tolDCs (siCTL) and tolDCs (siMAFB) (n = 7) (ns p > 0.05, * p < 0.05, ** p ≤ 0.01). (F) Box-plots of supernatant concentration from DCs (siCTL), tolDCs (siCTL) and tolDCs (siMAFB) (n = 7) of IL-10 in steady-state and stimulated conditions (LPS 10 ng/μL and IFNγ 20 ng/μL) and IL-12p70 and TNFα under stimulated conditions (pg/mL). TNFα and IL-12p70 in steady state were not detected. (ns p > 0.05, * p < 0.05, ** p ≤ 0.01) (G) DC (siCTL), tolDC (siCTL) and tolDC (siMAFB) were cocultured with CD8+ cells for 5 days (n = 4). The final CFSE signal of CD8+ cells is shown (left panel). CD8+ with only CD3/CD28 T-activator beads (C+) or alone (C-) are also shown. On the right panel, the average proliferation of the quadruplicate is shown (mean ± standard error of the mean (SEM)) (** p ≤ 0.01, *** p ≤ 0.001).

Article Snippet: Enzyme-linked immunosorbent assays (ELISA) were performed, following the manufacturer’s instructions: Human IL-10, Human IL-12p70, and Human TNFα from BioLegend, and Human IL-1β from ThermoFisher.

Techniques: Control, DNA Methylation Assay, Methylation, Fluorescence, Flow Cytometry, Concentration Assay

Journal: Cell metabolism

Article Title: A methionine-Mettl3- N 6 -methyladenosine axis promotes polycystic kidney disease

doi: 10.1016/j.cmet.2021.03.024

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-METTL3 Abcam ab195352 Anti-METTL3 Invitrogen MA5-27527 Anti-m 6 A Abcam ab151230 Anti-c-Myc Abcam ab185656 Anti-c-Myc Sigma OP10-200UG Anti-Avpr2 EMD AB1797P Anti-Puromycin Developmental Studies Hybridoma Bank PMY-2A4 Anti-HA Cell Signaling #3724 Anti-PCNA Santa Cruz sc-7907 Anti-pHH3 Sigma H0412 Anti-pCreb1 Cell Signaling 9198S Anti-Yap Cell Signaling #4912 Anti-GFP Aves GFP-1020 Anti-DBA Vector Laboratories B-1035 Anti-Mettl14 Sigma HPA038002 Bacterial and Virus Strains Ad-CMV-iCre virus Vector Biolabs #1045 Biological Samples Normal human and ADPKD kidney samples PKD Biomarkers and Biomaterials Core in the Kansas PKD Center at the Kansas University Medical Center (KUMC) Chemicals, Peptides, and Recombinant Proteins Puromycin Invitrogen A1113803 O-Propargyl-Puromycin JenaBioScience NU-931-5 8-Br-cAMP Sigma B7880 alamarBlue Invitrogen DAL1025 methionine Sigma M5308 s-adenosylmethionine Cayman Chemicals 13956 s-adenosylhomocysteine Cayman Chemicals 13603 Critical Commercial Assays m 6 A elisa kit Epigentek P-9005-96 SAM elisa kit Cell Biolabs STA-671-C Magna MeRIP™ m 6 A Kit EMD Millipore 17-10499 Submitted data MeRIP-seq NCBI Gene Expression Omnibus GSE165956 RNA-seq NCBI Gene Expression Omnibus GSE165956 Experimental Models: Organisms/Strains Ksp/Cre Shibazaki et al., 2008 N/A Ksp/rtTA Pan et al., 2013 N/A tetO-Cre Jackson Laboratories Stock No: 006234 Pkd1 F/F Jackson Laboratories Stock No: 010671 Pkd1 RC/RC ( PKD1 p.R3277C) Hopp et al., 2012 N/A Mettl3 F/F UT Southwestern Med Ctr N/A Mettl3 Tg UT Southwestern Med Ctr N/A mIMCD3 cells ATCC CRL 2123 Oligonucleotides siRNA against Mettl3 (UGGUUUACAUGUCGACUAA, UGGUUUACAUGUUGUGUGA, UGGUUUACAUGUUUUCUGA, UGGUUUACAUGUUUUCCUA) Dharmacon L-049446-01-0020 Scrambled siRNAs (ACAGCAGGCACAGACAGGCAGU) Dharmacon D-001810-10-20 Recombinant DNA Plasmid - CAG-LSL-Mettl3cDNA-HA/HA/HA-IRES-GFP This paper N/A Plasmid - pLightSwitch Empty (pLS) 3′-UTR Switchgear Genomics S890005 Plasmid - pGL3 Promega E1751 Software and Algorithms Imagej NIH https://imagej.nih.gov/ij/ Zen blue software Zen https://www.zeiss.com/microscopy/us/products/microscope-software/zen-lite.html ImageLab Bio-rad https://www.bio-rad.com/en-us/product/image-lab-software?ID=KRE6P5E8Z Ingenuity Pathway Analysis (IPA) Qiagen https://analysis.ingenuity.com/pa/installer/select Prism Graphpad https://www.graphpad.com/scientific-software/prism/ Integrative Genomics Viewer (IGV) Broad Institute http://software.broadinstitute.org/software/igv/ Open in a separate window KEY RESOURCES TABLE.

Techniques: Plasmid Preparation, Virus, Recombinant, Enzyme-linked Immunosorbent Assay, Gene Expression, Software

Journal: Scientific Reports

Article Title: Bacterial DNA promotes Tau aggregation

doi: 10.1038/s41598-020-59364-x

Figure Lengend Snippet: Effect of DNA extracted from diverse sources on tau aggregation. To study the effect of DNA on tau aggregation, monomeric tau (22 µM) under the conditions described in Fig. , was incubated with preparations containing 100 ng of DNA extracted from different bacterial species including Pseudomonas aeruginosa (PA), Tetzosporium hominis (TH), Tetzerella alzheimeri (TA), Escherichia coli ATCC 25922 (EC25), Escherichia coli ATCC 472217 (EC47), Porphyromonas gingivalis (PG), Borrelia burgdorferi (BB). We also incubated tau with same amount of DNA extracted from Candida albicans (CA) and human samples. In all experiments the signal at time zero, corresponding to buffer + DNA + heparin + ThT + monomeric tau was substracted from the values. ( A ) tau aggregation was monitored over time by ThT fluorescence. Data corresponds to the average ± standard error of experiments done in triplicate (except for control without seeds that was performed in quintuplicate). ( B ) The lag phase, estimated as the time in which ThT fluorescence was higher than the threshold of 40 arbitrary units, was calculated for each experiment. The points represent the values obtained in each of the replicates. Data was analyzed by one-way ANOVA, followed by Tukey multiple comparison post-test. *P < 0.01; **P < 0.001.

Article Snippet: Lane 1, XL 1 kb Plus DNA Marker; Lane 2 DNA P. aeruginosa ; Lane 3 DNA T. hominis ; Lane 4 DNA T. alzheimeri ; Lane 5 DNA C. albicans ; Lane 6 DNA E. coli ATCC 472217; Lane 7 DNA E. coli ATCC 25922; Lane 8 Human DNA; Lane 9 DNA B. burgdorferi ; Lane 10 DNA P. gingivalis .

Techniques: Incubation, Fluorescence, Control, Comparison

Journal: Scientific Reports

Article Title: Bacterial DNA promotes Tau aggregation

doi: 10.1038/s41598-020-59364-x

Figure Lengend Snippet: Influence of different concentration of E. coli ATCC 25922 DNA on tau aggregation. To study whether the promoting effect of E. coli DNA can be observed at different concentrations of DNA, we incubated monomeric tau under the conditions described above (Figs. and ) with 1000, 100 and 10 ng of DNA extracted from E. coli ATCC 25922. ( A ) tau aggregation was monitored overtime by ThT fluorescence. Data corresponds to the average ± standard error of experiments done in triplicate. ( B ) The lag phase, estimated as the time in which ThT fluorescence was higher than the threshold of 40 arbitrary units, was calculated for each experiment. The points represent the values obtained in each of the replicates. Data was analyzed by one-way ANOVA, followed by Tukey multiple comparison post-test. *P < 0.01; **P < 0.001.

Article Snippet: Lane 1, XL 1 kb Plus DNA Marker; Lane 2 DNA P. aeruginosa ; Lane 3 DNA T. hominis ; Lane 4 DNA T. alzheimeri ; Lane 5 DNA C. albicans ; Lane 6 DNA E. coli ATCC 472217; Lane 7 DNA E. coli ATCC 25922; Lane 8 Human DNA; Lane 9 DNA B. burgdorferi ; Lane 10 DNA P. gingivalis .

Techniques: Concentration Assay, Incubation, Fluorescence, Comparison

Journal: Scientific Reports

Article Title: Bacterial DNA promotes Tau aggregation

doi: 10.1038/s41598-020-59364-x

Figure Lengend Snippet: Agarose gel electrophoresis images of DNA. Lane 1, XL 1 kb Plus DNA Marker; Lane 2 DNA P. aeruginosa ; Lane 3 DNA T. hominis ; Lane 4 DNA T. alzheimeri ; Lane 5 DNA C. albicans ; Lane 6 DNA E. coli ATCC 472217; Lane 7 DNA E. coli ATCC 25922; Lane 8 Human DNA; Lane 9 DNA B. burgdorferi ; Lane 10 DNA P. gingivalis .

Article Snippet: Lane 1, XL 1 kb Plus DNA Marker; Lane 2 DNA P. aeruginosa ; Lane 3 DNA T. hominis ; Lane 4 DNA T. alzheimeri ; Lane 5 DNA C. albicans ; Lane 6 DNA E. coli ATCC 472217; Lane 7 DNA E. coli ATCC 25922; Lane 8 Human DNA; Lane 9 DNA B. burgdorferi ; Lane 10 DNA P. gingivalis .

Techniques: Agarose Gel Electrophoresis, Marker

Journal: Communications Biology

Article Title: Anti-tumor effects of P-LPK-CPT, a peptide-camptothecin conjugate, in colorectal cancer

doi: 10.1038/s42003-022-04191-1

Figure Lengend Snippet: a The FITC-P-LPK conjugate emitted stronger green fluorescence in CRC cells than normal NCM460 cells. Bar,10 μm. b The FITC-P-LPK conjugate selectively binds to CRC tissues (HE staining) Bar, 50 μm. c , d The fluorescence intensity of the P-LPK peptide in CRC cells ( c ) and tissues ( d ) was significantly higher than that of normal cells and tissues ( n = 3, means ± SD, NCM460: P-CON vs P-LPK, p = 0.9385; Colo320HSR: P-CON vs P-LPK, p < 0.0001; HCT116: P-CON vs P-LPK, p < 0.0001; LoVo: P-CON vs P-LPK, p = 0.0219; Adjacent normal tissues: P-CON vs P-LPK, p = 0.9934;Colon cancer tissues: P-CON vs P-LPK, p < 0.0001) (* p < 0.05, **** p < 0.0001). e The binding site of the P-LPK peptide in HCT116 cells was investigated after labeling the peptide with Rhodamine. Bar, 25 μm.

Article Snippet: The human CRC cell lines Colo320HSR, HCT116, LoVo, HT29, and SW480 were all obtained from the American Type Culture Collection (ATCC, Manassas, VA).

Techniques: Fluorescence, Staining, Binding Assay, Labeling

Journal: Communications Biology

Article Title: Anti-tumor effects of P-LPK-CPT, a peptide-camptothecin conjugate, in colorectal cancer

doi: 10.1038/s42003-022-04191-1

Figure Lengend Snippet: a – c Illustration of how the P-LPK-CPT conjugate was synthesized (Details reference to materials and methods). d The colonal forming capability after different treatments with the P-LPK-CPT conjugate of HCT116, LoVo and NCM460 cells. e Cell proliferation was measured by CCK-8 ( n = 5, means ± SD, HCT116: CPT vs P-LPK-CPT, p = 0.0005; P-CON-CPT vs P-LPK-CPT, p = 0.0002; LoVo: CPT vs P-LPK-CPT, p < 0.0001; P-CON-CPT vs P-LPK-CPT, p = 0.0004) (** p < 0.01, *** p < 0.001, **** p < 0.0001). f The proportion of cells in the DNA synthesis state was qualified and one-way analysis of variance is used to test the difference between groups ( n = 3, means ± SD, HCT116: CPT vs P-LPK-CPT, p = 0.0017; P-CON-CPT vs P-LPK-CPT, p = 0.0015; LoVo: CPT vs P-LPK-CPT, p = 0.0016; P-CON-CPT vs P-LPK-CPT, p = 0.0018) (** p < 0.01).

Article Snippet: The human CRC cell lines Colo320HSR, HCT116, LoVo, HT29, and SW480 were all obtained from the American Type Culture Collection (ATCC, Manassas, VA).

Techniques: Synthesized, CCK-8 Assay, DNA Synthesis

Journal: Communications Biology

Article Title: Anti-tumor effects of P-LPK-CPT, a peptide-camptothecin conjugate, in colorectal cancer

doi: 10.1038/s42003-022-04191-1

Figure Lengend Snippet: a , b Western blotting analysis of SLC1A5 in NCM460, HCT116, LoVo, SW480, HT29 and Colo320HSR cells. After knocking down SLC1A5 in HCT116 and HT29, the binding intensity of FITC-P-LPK to cells was observed by confocal microscopy. Bar, 10 μm. c , d Effects of different endocytosis inhibitors on the internalization of FITC-P-LPK. HCT116 cells were pre-treated with 10 µM chlorpromazine, 50 μM methyl-β-cyclodextrin, 20 µM Amiloride hydrochloride for 30 min at 37 °C. Subsequently, the cells were incubated with FITC-P-LPK for 2 h. Then the fluorescence intensity was observed by confocal microscopy and detected using a multi-well plate reader ( n = 5, means ± SD, NC vs CPZ, p = 0.0001; NC vs MβCD, p = 0.9069; NC vs EIPA, p = 0.9812) (**** p < 0.0001). Bar, 10 μm. e The competition experiment with SLC1A5 substrates glutamine. FITC-P-LPK was incubated with increasing concentrations (0–32 mM) of glutamine in HCT116 cells at 37 °C for 2 h. The fluorescence intensity was measured in a multi-well plate reader ( n = 5, means ± SD).

Article Snippet: The human CRC cell lines Colo320HSR, HCT116, LoVo, HT29, and SW480 were all obtained from the American Type Culture Collection (ATCC, Manassas, VA).

Techniques: Western Blot, Binding Assay, Confocal Microscopy, Incubation, Fluorescence

Journal: eBioMedicine

Article Title: Cytotoxic CD161 − CD8 + T EMRA cells contribute to the pathogenesis of systemic lupus erythematosus

doi: 10.1016/j.ebiom.2023.104507

Figure Lengend Snippet: DTHD1 deficiency increased the cytotoxicity of CD161 − CD8 + T EMRA cells . (a) Heatmap showing the correlation of co-expression modules with different cell subsets. (b) Functional annotations of DTHD1-related genes. (c) Quantification (left) and flow cytometry (right) of the apoptosis percentage of P815 cells after cocultured with primary CD8 + T cells electroporated with si-NC or si- DTHD1 siRNAs for 5 h at the ratio of 1:5. P value is determined by Unpaired t-test, P = 0.0124. (d) Flow cytometric analysis of mean fluorescence intensity (MFI) of Granzyme B of CD161 − CD8 + T cells electroporated with si-NC or si- DTHD1 siRNAs after coculture with P815 cell. P value is calculated by Unpaired t-test, P = 0.0012. (e) Structural prediction of DTHD1-MYD88 interaction by ZDOCK. Grey, DTHD1; blue, MYD88; red, mutated regions in DTHD1 . (f) Western blotting analysis of HA in HEK293T cells co-transfected with myc-MYD88 and HA-empty vector or HA-DTHD1 (WT) or HA-DTHD1 (Mutant) expressing plasmids after immunoprecipitated with anti-Myc beads. (g) Boxplot indicating the average expression of MYD88 in CD161 − CD8 + T EMRA cells in HCs and SLE samples from our dataset. P value is from Wilcoxon rank-sum test. (h) Luciferase activity analysis of lysates of HEK293T cells co-transfected luciferase reporter plasmid for NF-κB, pRL-TK-renilla-luciferase plasmid, MYD88 plasmid and WT-DTHD1 plasmid or mutant DTHD1 plasmid ( n = 6). P values are determined by Unpaired t-test. (i) Quantification (left) and flow cytometry (right) of the apoptosis percentage of P815 cells after cocultured with primary CD8 + T cells pre-treated with DMSO or TAK-242 for 5 h at the ratio of 1:5. P value is determined by Unpaired t-test, P = 0.0024. One representative experiment of three is shown (f). ∗ P < 0.05, ∗∗ P < 0.01, ∗∗∗ P < 0.001.

Article Snippet: Human MYD88 cDNA was purchased from Genecopoeia Inc. and cloned into the pcDNA3.1-Myc plasmid.

Techniques: Expressing, Functional Assay, Flow Cytometry, Fluorescence, Structural Proteomics, Western Blot, Transfection, Plasmid Preparation, Mutagenesis, Immunoprecipitation, Luciferase, Activity Assay

Journal: eBioMedicine

Article Title: Cytotoxic CD161 − CD8 + T EMRA cells contribute to the pathogenesis of systemic lupus erythematosus

doi: 10.1016/j.ebiom.2023.104507

Figure Lengend Snippet: CD161 − CD8 + T EMRA cells contribute to SLE by LIGHT signaling . (a) The number (top) and strength (bottom) of interaction among all cells in HCs and SLE samples. (b) Heatmap of differential interactions between HCs and SLE samples in cell–cell communication network. The top bar indicates the sum of incoming signaling and right bar indicates the sum of outgoing signaling. Red indicates increased signaling and blue indicates decreased signaling in SLE. (c) Number of significant ligand-receptor pairs between CD161 − CD8 + T EMRA cells (outgoing) and other cell subclusters (incoming) in HCs (left) and SLEs (right). The relative number of ligand-receptor pairs is represented by the edge width. (d) Comparison of the significant outgoing signaling from CD161 − CD8 + T EMRA cells between HC and SLE. Empty space means the communication probability is zero. P -values are computed from one-sided permutation test. ∗∗∗ P < 0.001. (e) qPCR analysis of TNFSF14 expression in primary CD8 + T cells electroporated with empty vector, DTHD1-WT or DTHD-mut plasmid cocultured with THP1 cells ( n = 3). P values are determined by unpaired t-test. (f) Receiver operating curve for out-of-sample prediction of case–control state by a logistic regression model trained on DEGs in CD161 − CD8 + T EMRA cells. DEGs include IFI27 , IFI44L , RSAD2 , IFI44 , FAM118A , LGALS9 , MX1 , EPSTI1 , USP18 , OAS3 , LAIR2 , IFIT1 , XAF1 . Inset depicts the changes of DEGs in the public transcriptome profile and CD161 − CD8 + T EMRA cells. (g) Graphic abstract showing the expansion of CD161 − CD8 + T EMRA in patients with SLE and DTHD1 downregulation promotes MYD88-mediated expansion and cytotoxicity of this pathogenic CD161 − CD8 + T EMRA subset in SLE.

Article Snippet: Human MYD88 cDNA was purchased from Genecopoeia Inc. and cloned into the pcDNA3.1-Myc plasmid.

Techniques: Comparison, Expressing, Plasmid Preparation, Control

Journal: bioRxiv

Article Title: Invasion of glioma cells through confined space requires membrane tension regulation and mechano-electrical coupling via Plexin-B2

doi: 10.1101/2024.01.02.573660

Figure Lengend Snippet: (A) Schematic of CRISPR/Cas9-mediated PLXNB2 knockout (KO) with small guide (sg) RNA targeting second coding exon. (B) Western blots show Plexin-B2 expression in different SD2 GSCs, with β-actin as loading control. Note Plexin-B2 precursor at 240 kDa and mature form at 170 kDa. (C) IF images show Plexin-B2 expression in different SD2 GSCs, with Hoechst nuclear counterstain. (D) Left, schematic of atomic force microscopy (AFM) indentation method to probe cell stiffness by cantilever deflection. Middle, AFM indentation curves of different SD2 GSCs; right, box plots of cell stiffness, showing 25– 75% quartiles, median (line), and mean (plus sign). n= 6 cells per group. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. (E) Left, depiction of membrane tension measurement with optical tweezers. Middle, force measurements during tether extrusion (shaded box). Right, quantifications of tether extrusion forces. n=5 cells per group. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. (F) Left, schematic of FLIM of cell membranes labeled with Flipper-TR membrane dye, with low and high membrane tension associated with shorter and longer lifetimes, respectively. Middle top, representative FLIM images, with lifetime heatmap shown on right. Middle bottom, images show similar fluorescence intensities of Flipper-TR dye in WT and PB2 KO cells. Right top, violin plots show fluorescence lifetime from 3 images per group. Two-sided unpaired t-test. Right bottom, phasor plots of FLIM image data, with arrow indicating a shift to shorter lifetime values for PB2 KO cells. (G) Model of Plexin-B2 regulation of cortical contractility and membrane tension. Phalloidin staining show differences of F-actin network in WT and PB2 KO SD2 GSCs. DAPI for nuclear staining. Arrows point to stress fibers and spread-out contours of the WT GSCs.

Article Snippet: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) .

Techniques: CRISPR, Knock-Out, Western Blot, Expressing, Control, Microscopy, Membrane, Labeling, Fluorescence, Staining

Journal: bioRxiv

Article Title: Invasion of glioma cells through confined space requires membrane tension regulation and mechano-electrical coupling via Plexin-B2

doi: 10.1101/2024.01.02.573660

Figure Lengend Snippet: (A) Top, timeline for dextran uptake assay. Bottom, live-cell imaging of WT and PB2 KO SD2 GSCs labeled with SPY-Actin and exposed to dextran-Alexa488. Enlarged images of boxed areas are shown below. Quantification of the areas of dextran + clusters per cell are shown in box plots, with 25–75% quartiles, median (line), and mean (plus sign). n=85 cells for WT, n=44 cells for PB2 KO. Mann–Whitney–Wilcoxon test. (B) Top, live cell confocal plane images of WT and PB2 KO GSCs with side views of z-stacks showing intracellular localization of diffuse dextran-Alexa 488 signals in PB2 KO cells in addition to dextran endosome signals. In contrast, WT cells contained only dextran + endosomes. Bottom, histograms show fluorescence profiles showing bimodal distribution of dextran-Alexa 488 fluorescence intensities in PB2 KO GSCs (blue and brown arrows). n=177 cells for WT, n=161 cells for PB2 KO. Mann–Whitney–Wilcoxon test. (C, D) Left, schematic of myr-palm-GFP or -CFP attached to inner membrane leaflet. Right, live cell fluorescence imaging at 72 hr after transfection shows internalization of myr-palm-GFP or -CPF on endomembranes (arrow) in WT GSCs, in contrast to membrane retention of the probes (arrowhead) in PB2 KO GSCs. (E) Left, schematic of TauSTED super-resolution microscopy of GSCs labeled with MemGlow. Middle, TauSTED live-cell images show reduced endosomes (arrowheads) in PB2 KO cells compared to WT. Right, box plots show areas of MemGlow clusters in each cell. n=26 cells for WT, n=13 cells for PB2 KO. Two-sided unpaired t-test. (F) Working model of regulation of cortical and membrane tension by Plexin-B2, affecting endocytosis and membrane permeability in GSCs.

Article Snippet: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) .

Techniques: Live Cell Imaging, Labeling, MANN-WHITNEY, Fluorescence, Membrane, Imaging, Transfection, Super-Resolution Microscopy, Permeability

Journal: bioRxiv

Article Title: Invasion of glioma cells through confined space requires membrane tension regulation and mechano-electrical coupling via Plexin-B2

doi: 10.1101/2024.01.02.573660

Figure Lengend Snippet: (A) Left, schematic of PH(PLCδ1)-GFP PIP2 probe. Right, live-cell imaging at 72 hr post transfection reveals that the PH(PLCδ1)-GFP probes were largely internalized in WT GSCs (arrow), but retained on membrane of PB2 KO GSCs (arrowhead). (B) Left, still images of videography show accumulation of the PH(PLCδ1)-GFP probes (arrow) in front of the nucleus (NucSpot) of migrating WT SD2 GSCs in tunnels, more so in 3 than 8 µm tunnel, but not in PB2 KO cells. Dashed lines delineate cell boundary. Long arrow denotes direction of migration. Right, quantifications of the ratio of PH(PLCδ1)-GFP fluorescence intensity at front vs. rear of GSCs during passage. n=13-16 cells per condition. One-way ANOVA followed by Tukey’s multiple comparison test. Data represent mean ± SEM. (C) Left, schematic of R(+8)-pre-GFP probe for negative surface charge of inner plasma membrane. Right, live-cell imaging at 72 hr post-transfection shows internalization of the probes (arrow) in WT GSCs, in contrast to the predominant membrane localization in PB2 KO GSCs (arrowhead). (D) Left, still images of videography show accumulation of the R(+8)-pre-GFP probes (arrow) at front zone of WT GSCs when traversing the 3 µm tunnel, but not in PB2 KO cells. Right, bar graphs show the ratio of R-pre-GFP fluorescence intensity at rear vs. front of GSCs when passing through tunnels. n=22 cells for WT, n=27 cells for PB2 KO. Mann–Whitney–Wilcoxon test. Data represent mean ± SEM. (E) Diagram illustrating voltage sensitive FluoVolt membrane dye, with fluorescent intensity quenched by voltage-sensitive electron transfer from electron-rich donor mediated by “molecular wire” in plasma membrane. (F) Left, FluoVolt live-cell imaging shows reduced FluoVolt fluorescent intensity in cell membrane of Plexin-B2 KO cells, consistent with higher negative charges of inner membrane. Right, box plots of membrane FluoVolt intensity. n=25 cells for WT, n=27 cells for PB2 KO. Two-sided unpaired t-test. Data represent mean ± SEM. (G) Left, still images from videography show higher FluoVolt fluorescent signals at rear zone (arrowhead) of WT GSCs when traversing tunnels, more so in 3 than 8 µm tunnel, but not in PB2 KO cells. Migration direction is denoted by long arrow. Right, bar graphs show the ratio of FluoVolt intensity at rear vs. front during confined migration. n=15 cells per group. One-way ANOVA followed by Tukey’s multiple comparison test. Data represent mean ± SEM. (H) Live-cell images and quantifications show the effects of constitutive active (CA) RAP1B-V12 or dominant-negative (DN) RAP1B-N17 on FluoVolt intensity in WT or PB2 KO GSCs. n=25 cells per group. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. (I) Left, still images capture calcium localization (Fluo4-AM fluorescence, arrowhead) at the rear of WT GSCs when traversing tunnels, more so in 3 than 8 µm tunnel, but not in PB2 KO cells. Migration direction is denoted by long arrow. Right, bar graphs showing Fluo4-AM intensity ratio at rear vs. front in GSC during passage through tunnels. n=15-16 cells. One-way ANOVA followed by Tukey’s multiple comparison test. Data represent mean ± SEM. (J) Left, still images from videography show that calcium chelator BAPTA-AM disrupted the pattern of high FluoVolt signals at the rear of WT GSCs (arrowhead) during confined migration. Right, bar graphs show FluoVolt intensity ratio at rear vs. front of GSCs when traversing tunnels. n=21 cells for WT, n=16 cells for PB2 KO. Two-sided unpaired t-test. Data represent mean ± SEM. (K) Model of Plexin-B2 signaling affecting membrane surface charge and electric field during polarized confined migration, with PIP2 enrichment at cell front and Ca 2+ at rear zone, leading to asymmetry of FluoVolt and R(+8)-pre-GFP.

Article Snippet: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) .

Techniques: Live Cell Imaging, Transfection, Membrane, Migration, Fluorescence, Comparison, Clinical Proteomics, MANN-WHITNEY, Dominant Negative Mutation

Journal: bioRxiv

Article Title: Invasion of glioma cells through confined space requires membrane tension regulation and mechano-electrical coupling via Plexin-B2

doi: 10.1101/2024.01.02.573660

Figure Lengend Snippet: (A) Structure model of the extracellular domain of human Plexin-B2 show the locations of lock1 and lock2 mutations predicted to form disulfide bridges that lock the ring structure. (B) Western blots show absence of mature Plexin-B2 (170 kDa) in PB2 KO GSC, and expression of lock mutants in PB2 KO SD2 and SD3 GSCs. β-actin serves as a loading control. (C) Still images from videography show passage of GSCs (nuclei visualized by NucSpot) through microchannels with PB2 wildtype rescue construct but not lock mutants, nor PB2 with deletion of extracellular domain (dECTO). Chevrons point to 3 µm constrictions. (D) Box plots show velocity through constrictions, stalling time at constrictions, and sum of forward and backward movements, with 25–75% quartiles, minimal and maximal values (whiskers), median (line), and mean (cross). For velocity and sum of movements: n=17-20 cells per condition. For stalling time at constriction: n=14-28 cells per condition. One-way ANOVA followed by Dunnett’s multiple comparisons test. (E) Still images from videography show F-actin assembly (SPY-actin, arrowhead) at cell rear and MemGlow + endosomes (arrow) at cell front of SD3 GSCs with Plexin-B2 WT rescue but not mutant rescues when traversing 3 µm constrictions (chevrons). (F) Bar graphs showing fluorescence intensity ratio of SPY-actin and MemGlow at rear vs. front of GSCs during confined migration. n=10-18 cells per condition. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. Data represent mean ± SEM. (G) Model of Plexin-B2 signaling and mechano-electrical regulation of membrane tension and membrane surface charge during polarized confined migration. Regionalized enrichment of endocytosis/PIP2 at cell front and F-actin/Ca 2+ at rear zone lead to asymmetry of FluoVolt and R(+8)-pre-GFP membrane probes.

Article Snippet: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) .

Techniques: Western Blot, Expressing, Control, Construct, Mutagenesis, Fluorescence, Migration, Membrane

Journal: The Journal of Experimental Medicine

Article Title: Multi-omic comparison of Alzheimer’s variants in human ESC–derived microglia reveals convergence at APOE

doi: 10.1084/jem.20200474

Figure Lengend Snippet: Integrating AD-associated genetic variations into an hMGL model. (A) Schematic depiction of AD-associated risk variants characterized. SNP variants for CD33 and INPP5D , as well as R47H, A528T, and R744X coding variants for TREM2 and SORL1 (SORLA) are marked in red. ITIM, immunoreceptor tyrosine-based inhibitory motif. (B) Workflow pipeline, for generating and characterizing AD-associated mutations in hMGLs. AD-associated coding or noncoding SNPs are introduced into corresponding genomic loci in human H9 ESC lines by CRISPR-Cas9 editing. Each line was characterized for targeted mutations and off-targeting variation before differentiation and maturation into hMGLs. hMGLs were subjected to multi-omic (RNA-seq, ATAC-seq, ChIP-seq, and label-free proteome) analysis, and functional characterization as indicated. (C) Isogenic microglial differentiation scheme used in this study. ESCs were differentiated into HPCs for 10 d, where CD43 + iHPCs are sorted (FACS plots) and cultured in serum-free media with MCSF, IL-34, TGF-β, and insulin; CD43 (green), CX3CR1 (red), Iba1 (purple), and DAPI (blue) staining is shown for HPCs at 10 d in vitro (DIV). Cells were differentiated to microglia for an additional 25 d, whereby maturation was induced by the addition of CD200 and CX3CL1. hMGLs were stained for TREM2 (red), CD43 (green), Iba1 (purple), and DAPI (blue) and compared with HPCs (bottom panels), or TMEM119 in hMGLs (red, bottom right) as indicated. Scale bars represent 100 µm (H9, left panel), 50 µm (mature hMGLs, right panel), and 20 µm (all fluorescence images). (D) Heatmap depicting RNA-seq profiles from human microglia (red; ; GSE99074 , red), hMGLs from this study (purple), iMGLs ( ; GSE117829 , green). (E) 3D PCA of hMGLs (this study, purple), iMGLs ( GSE117829 , turquoise; GSE89189 , dark blue), human fetal microglia ( GSE89189 , green), human adult microglia ( GSE89189 , light blue), myeloid dendritic cells ( GSE89189 , light yellow), monocytes ( GSE89189 , gold). PCA reveals that hMGLs cluster closely with iMGLs and human adult/fetal microglia, and are distinct from myeloid cells.

Article Snippet: 100-nt single-stranded oligodeoxynucleotide (ssODN) repair templates (PAGE purified; Integrated DNA Technology) were designed with homologous genomic sequences flanking the predicted CRISPR-Cas9 cleavage site ( ).

Techniques: CRISPR, RNA Sequencing Assay, ChIP-sequencing, Functional Assay, Cell Culture, Staining, In Vitro, Fluorescence

Journal: The Journal of Experimental Medicine

Article Title: Multi-omic comparison of Alzheimer’s variants in human ESC–derived microglia reveals convergence at APOE

doi: 10.1084/jem.20200474

Figure Lengend Snippet: Gene targeting and experimental strategy for hMGL differentiation and characterization. (A) Schematic representation of the genomic location and intron/exon schematic of AD risk SNPs CD33 , INPP5D , TREM2 , and SORL1 in this study. (B) Schematic diagram of the analytical workflow for this study. RNA-seq datasets from the hMGL lines (1) are analyzed for cross-regulatory interactions to generate an epistatic model (2) and identify potential pathogenic effectors or signatures. hMGL lines are characterized for physiological microglial function (3) and interactions with Aβ in immunodeficient human MCSF knockin mouse brain xenotransplants (4). (C) Representative sequences of various isogenic clones in AD-associated mutant ESC lines and H9-WT sequences. Repair single-strand donor (ssODN) templates, sgRNA (gray), corresponding amino acids, DNA directionality (arrow, 5′ to 3′) and nucleotide substitutions are shown. For TREM2 R47H , two synonymous mutations were introduced in the repair ssODN, generating a new HindIII restriction site (lowercase) for consequent clone screening. (D) Sanger sequencing and validation of CD33 SNP, INPP5D SNP, TREM2 KO, TREM2 R47H , SORL1 KO, and SORL1 A528T lines and isogenic controls (nontargeting sgRNA). The WT H9 ESC line is heterozygous for G/A INPP5D SNPs; CRISPR-Cas9 editing was performed to convert H9 homozygously to the INPP5D “A” allele. All other modifications were converted homozygously in the H9 ESC lines. (E) After maturation induced by exposure to CD200 and CX3CL1, hMGLs were stained for CX3CR1 (red), CD43 (green), Iba1 (purple), and DAPI (blue) as indicated. Scale bar, 20 µm. (F) Representative inward currents from WT hMGLs; hyperpolarizing voltage steps from −160 mV to −60 mV were applied in the absence (top) or presence of Cs + (bottom). At right panel, quantification of inward currents as measured in the absence (black) or presence of Cs + (gray). (G) Induction of cytokines and chemokines in WT hMGLs stimulated with IL-1β (20 ng/ml) and IFN-γ (20 ng/ml) as determined by ELISA multiplex assay. Heatmaps indicate log 2 fold change of cytokines/chemokines indicated (MCP-1, GPOa, HGF, TNFα) above vehicle treatment. Results are from three replicate cultures in three independent experiments. (H) Representative time-lapse images showing WT hMGL migration toward to ATP source (a pipette tip). (I) Representative images of calcium imaging over the time periods as indicated with 100 µM ATP stimulation. Scale bar, 25 µm. Graphs (right) depict Ca 2+ traces depicting changes in Fluo-4 fluorescence over the baseline (ΔF/F0) in response to 100 µM ATP in the WT hMGLs. Results are derived from averaged values in three replicate cultures and three experiments. (J) Representative time-lapse images of fluorescent Aβ 1-42 oligomers (red) bound to WT hMGLs, imaged by automated live-cell microscopy. In the adjacent graph, phagocytosis of Aβ 1-42 oligomers in WT hMGLs over time was quantified, as depicted on the left. PI was determined by measuring average fluorescence intensity at each time point in comparison to the 15-min time point (set to 1.0). Images in E–J are representative of three independent experiments. Values represent mean ± SEM from n = 3 independent experiments.

Article Snippet: 100-nt single-stranded oligodeoxynucleotide (ssODN) repair templates (PAGE purified; Integrated DNA Technology) were designed with homologous genomic sequences flanking the predicted CRISPR-Cas9 cleavage site ( ).

Techniques: RNA Sequencing Assay, Knock-In, Clone Assay, Mutagenesis, Sequencing, CRISPR, Staining, Enzyme-linked Immunosorbent Assay, Multiplex Assay, Migration, Transferring, Imaging, Fluorescence, Derivative Assay, Microscopy